ResearchA trehalose 6-phosphate synthase gene of the hemocytes of the blue crab, Callinectes sapidus: cloning, the expression, its enzyme activity and relationship to hemolymph trehalose levelsCenter of Marine Biotechnology, University of Maryland Biotechnology Institute, 701 E. Pratt Street, Columbus Center, Suite 236. Baltimore, MD 21202, USA
Saline Systems 2008, 4:18doi:10.1186/1746-1448-4-18 The electronic version of this article is the complete one and can be found online at: http://www.salinesystems.org/content/4/1/18
©
2008 Chung; licensee BioMed Central Ltd. AbstractTrehalose in ectoderms functions in energy metabolism and protection in extreme environmental conditions. We structurally characterized trehalose 6-phosphate synthase (TPS) from hemocytes of the blue crab, Callinectes sapidus. C. sapidus Hemo TPS (CasHemoTPS), like insect TPS, encodes both TPS and trehalose phosphate phosphatase domains. Trehalose seems to be a major sugar, as it shows higher levels than does glucose in hemocytes and hemolymph. Increases in HemoTPS expression, TPS enzyme activity in hemocytes, and hemolymph trehalose levels were determined 24 h after lipopolysaccharide challenge, suggesting that both TPS and TPP domains of CasHemoTPS are active and functional. The TPS gene has a wide tissue distribution in C. sapidus, suggesting multiple biosynthetic sites. A correlation between TPS activity in hemocytes and hemolymph trehalose levels was found during the molt cycle. The current study provides the first evidence of presence of trehalose in hemocytes and TPS in tissues of C. sapidus and implicates its functional role in energy metabolism and physiological adaptation. BackgroundTrehalose, a non-reducing disaccharide is a primary energy source in prokaryotes, yeasts, plants, and invertebrates. The accumulation of trehalose in anhydrobioses of artemia, nematodes, and chironomids [1-3] implies a role in physiological and biochemical adaptations in extreme environmental conditions. In insects, trehalose is the major hemolymph sugar that is exclusively synthesized in the fat body in which hypertrehalosemic hormone (HTH) positively regulates its production. In addition, flight, feeding, and parasitic infections in insects have been shown to produce hypertrehalosemia, i.e. an increase in trehalose in hemolymph [4-6]. These findings further support trehalose as an energy source and its involvement in physiological adaptation in insects. Trehalose 6-phosphate synthase (TPS) is noted in insects as a fused gene that codes two functional domains in tandem: TPS, a homolog of Ost A of Escherichia coli, and trehalose 6-phophate phosphatase (TPP), a homolog of Ost B of E. coli. Drosophila TPS introduced into human HEK-293 cells increased hypoxia tolerance by which elevated trehalose reduced protein aggregation under hypoxia [2,7]. This result indicates two domains of TPS and TPP are active. However, a relationship between the level of TPS expression and TPS enzyme activity resulting in the increase in trehalose production has not been described in insects. In contrast to hypertrehalosemic response under stress and during flight activity in insects, the increase in glucose level in hemolymph (i.e. hyperglycemia) of crustaceans has been described during their initial physiological adaptation to stressful environments [8-15]. Lipopolysaccharide (LPS) injection, an accepted method for mimicking a pathogen infection, also induced hyperglycemia through modulating the level of crustacean hyperglycemic hormone [13]. The glycogen present in many crustacean tissues, including hemocytes, is tacitly accepted as the source of this hyperglycemia. Previous reports of the involvement of trehalose in osmoregulation and cold adaptation in crustaceans [16,17] and the ubiquitous abundance of trehalose in insect hemolymph as an energy source and its protective roles under stress emphasize the importance of this molecule in invertebrates. Therefore, we investigated the presence of TPS gene and trehalose in the blue crab, Callinectes sapidus, the population of which has been drastically declining in the Chesapeake Bay [18], in order to better understand the role of this sugar in energy metabolism during molt cycles and physiological adaptation under stressful conditions. Particularly, in an attempt to define an adaptive role of trehalose in a different physiological status of C. sapidus, we challenged animals with LPS that generally induced the response of a pathogen infection as well as the stress response of hyperglycemia in crustaceans [13,15]. We demonstrated hypertrehalosemic and hyperglycemic responses by LPS injection into the animal that was accompanied by increases in TPS expression and TPS enzyme activity in hemocytes. A relationship between TPS activity in hemocytes and the level of hemolymph trehalose during a molt cycle was established. Results and discussionPhylogenetic tree analysis of multiple sequence alignments of TPS geneCasHemoTPS (GenBank accession no. EU679406) consisting of 755 amino acid encodes a putative TPS and a TPP domain in tandem. Phylogenic tree analysis of multiple sequence alignments of TPS gene revealed that C. sapidus Hemocytes TPS (CasHemoTPS) is closely related to those of insects, forming a separate group from E. coli, Saccharomyces cerevisae, and Ulva prolifera (Fig. 1) [19]. The TPS gene in arthropods appears to be a fused gene of a homolog of Ost A and Ost B in E. coli.
Spatial distribution of TPS gene expression in various tissues of C. sapiduscDNAs of various tissues prepared from an adult male and female C. sapidus were tested for the TPS expression. As shown in Fig. 2, TPS expression was ubiquitous in all the tissues of both sexes of adult crabs, indicating that all these tissues could produce trehalose. It appears that multiple isoforms of TPS genes are present in tissues of the blue crab, as three of these, coding both TPS and TPP, have already been identified (unpublished observation). This wide distribution of TPS gene in crab tissues is surprising in contrast to what has been described in insects. In insects, the fat body is known as the exclusive biosynthetic site of trehalose [4,20,21]. After synthesis in the fat body, trehalose is released into hemolymph and serves as a major hemolymph sugar for energy required during flight.
The effect of LPS on the expression of TPS, TPS activity and trehalose levelsAnimals were challenged by the injection of 1 μg LPS to test the response of trehalose. The resting level of trehalose in hemocytes was higher than in hemolymph: 3.5 ± 0.3 mg (n = 6) (Fig. 3A) and 1.1 ± 0.1 mg/ml (n = 6), respectively. In contrast, the level of glucose was higher in hemolymph than in hemocytes: 180 ± 14.6 μg/ml (n = 6) and 70 ± 10 μg/mg protein in hemocyte extracts (n = 6), respectively (Fig. 3B). Overall, the concentration of trehalose was higher than glucose in both hemolymph and hemocytes: 6 and 50 fold, respectively, suggesting that trehalose is a major sugar in crab hemolymph as in insects [4,21]. The intracellular level of trehalose was increased ~2.5 fold in response to the LPS challenge, while a modest 1.5 fold elevation of glucose was found. LPS injection after 24 h did not cause general hypertrehalosemia or hyperglycemia in hemolymph in C. sapidus, although it was reported that a much higher dose of LPS induced hyperglycemia after 2 h in other crustacean species [13,15]. LPS induced a significant 2.5 fold increase in HemoTPS mRNA, a three fold increment of TPS activity, compared to those of the controls (Figs. 3C and 3D). This could be responsible for the increase in trehalose levels in Fig. 3A. A slight change (130%) in the level of trehalase (Treh) mRNA that breaks down trehalose into two glucose molecules is responsible for the modest rise (1.5 fold) in intracellular glucose. The basal level of TPS mRNA in hemocytes was ~100 fold less than that of Treh.
Our result demonstrates that hemocytes possess TSP and Treh for the synthesis and metabolism of trehalose. More importantly, they modulate cellular trehalose levels for physiological and biochemical adaptation under LPS challenge, through the dynamic regulation of the expression of TPS and TPS enzyme activity. Furthermore, our data indicate that C. sapidus expresses TPS in multiple tissues, in contrast to insects where the fat body is considered the exclusive biosynthesis site of this sugar. Considering trehalose is the major blood sugar, it is also likely to be involved in crustacean hyperglycemia. We anticipate its ubiquitous presence in most if not all crustacean hemolymph with similar functions as those found in insects. Levels of TPS activity in hemocytes and trehalose in hemolymph during a molt cycleConcentrations of trehalose in hemolymph of C. sapidus showed a bimodal pattern that exhibited two peaks during molt cycle, at early ecdysis and post ecdysis C1–3 (Fig. 4). The lowest level of trehalose (0.65 ± 0.05 mg/ml hemolymph, n = 8) was measured at stage A during and after the occurrence of the largest water intake occurred [22,23]. The fluctuation of TPS activity in hemocytes was also noted during the molt cycle from the lowest at intermolt to the highest at postmolt stage B: 0.3 ± 0.08 μmol/h/mg protein in hemocyte extracts (n = 12) and 1.98 ± 0.74 μmol/h/mg protein in hemocyte extracts (n = 7), respectively. TPP enzyme activity of HemoTPS was determined only at intermolt by measuring [Pi] in the same samples that were prepared for TPS activity. The activity of TPP was slightly high: 0.78 ± 0.41 μmol [Pi]/h/mg protein in hemocyte extracts (n = 5), however, this value was not significantly different from that of TPS activity. In general, TPS activity was elevated at premolt and peaked at stage B, which correlates with the highest concentration of trehalose noted at stage C1–3. The level of trehalose and TPS activity at the postmolt stage imply a possible involvement of this sugar in chitin synthesis, as found in insects [24]. Chitin synthesis is required for cuticle hardening and the calcification process in the exoskeleton of animals after ecdysis.
ConclusionWe isolated, for the first time in crustaceans, the cDNA sequence of the TPS gene coding functional and active domains of TPS and TPP in hemocytes of C. sapidus where its expression was widespread in most tissues. LPS injection into animals, mimicking the induction of internal stress, stimulated the expression and enzyme activity of TPS in hemocytes, resulting in the increase in intracellular trehalose in hemocytes. Our results provide evidence of the presence and a possible adaptive function of trehalose in energy metabolism and stress response of decapod crustaceans. Materials and methodsAnimalsJuvenile blue crabs, C. sapidus (20–30 mm carapace width), were received from the blue crab hatchery in the Aquaculture Research Center, Center of Marine Biotechnology (University of Maryland Biotechnology Institute, Baltimore, MD) and reared as described [25]. 5', 3' RACEs of C. sapidus TPS geneHemocytes were harvested from 1 ml hemolymph withdrawn in a sterilized marine anticoagulant (filtered through 0.22 μm membrane) at 1:1 ratio and immediately spun at 800 g for 10 min 4°C. After discarding the plasma, the pelleted cells were washed once in 100 μl of anticoagulant and re-centrifuged as above. The washed hemocytes were homogenized and total RNA extraction and quantification were carried out by following the procedures as described [26]. Degenerate primers of TPS were generated based on the conserved region of insect genes listed in GenBank using a multiple alignment program, CLUSTALW http://www.genome.jp webcite). The synthesis of 3' RACE cDNA of total RNA of hemocytes was carried out using GeneRacer™ (Invitrogen), while 5' RACE cDNAs was produced using SMART cDNA synthesis kit (BD Biosciences). Touchdown PCR was employed for initial amplification of TPS: dF1 (5'TTYGAYTCYTAYTAYAAYGG3') and dR1 (5'TCDCCRGCDCCRGCRAADGG3'). The cDNA was amplified with Advantage Taq polymerase (BD Biosciences) at the following PCR conditions: after initial denaturation for 2.5 min at 94°C, 3 cycles each step at annealing temperatures: 47°C, 45°C, and 43°C and the final step at 48°C for 25 cycles. The final amplification was achieved at annealing temperature 48°C. The touchdown PCR products served as templates for the nested PCR of TPS with a primer combination of dF2 (5' TTYTGGCCNYTNTTYCAYTCYATGCC 3') and dR2 (5'ATYTGRCARGCSACRAAYTC3') at 55°C annealing temperature. For the TPS gene, the cDNA from hemocytes produced a band with an expected size of 900 bp. The cloning and sequencing procedures were as stated [27]. Based on the obtained C. sapidus sequences of TSP, the following gene specific primers (listed in table 1) were made for the completion of 5', 3' RACE. Table 1. The list of primer sequences that was used for cloning of TPS gene and QRT-PCR Spatial distribution of TPS in various tissues of C. sapidusTissues were collected from male and female crabs at intermolt stage after they were anesthetized on ice as follows: eyestalk, brain, thoracic ganglion, antennal gland, gill, hindgut, heart, chelae muscle, hypodermis, testis or ovary, hepatopancreas, and Y-organ. Total RNAs were extracted using TRIzol® (Invitrogen) and quantified with a NanoDrop 1000 (Thermo Scientific). After treatment with DNase I to eliminate genomic DNA contamination, one μg of total RNAs were used for the first cDNA synthesis with MMLV and random hexamers (Promega). Samples of cDNAs (each 12.5 ng) were amplified with a combination of primers: forward, 5'ATGTTGGTGGAACACAATTCAAGGAC3' and reverse, 5' TACAGAAGAGTCTCGGTAGAATGCA for TPS. Arginine kinase, a reference gene, was amplified using the same primers as described [27]. The PCR conditions were as follows: initial denaturation at 94°C for 2.5 min, 35 cycles at 94°C for 20 sec, 60°C for 20 sec, 70°C for 30 sec sec, and final step at 70°C for 5 min. PCR products were visualized by staining with ethidium bromide after electrophoresis on a 1.5% agarose gel. Lipopolysaccharide challengePrior to the injection of LPS or saline, 100 μl of hemolymph was withdrawn from juvenile animals (70–90 mm, carapace width) as described [27] to establish the resting levels of glucose and trehalose in hemocytes. Animals in the test group received 1 μg LPS (E. coli 0111:B4, Sigma) in 100 μl crustacean saline, while control animals received 100 μl saline alone. 24 h after injection, 500 μl of hemolymph were withdrawn in an anticoagulant at a ratio of 1:1 and immediately centrifuged as described above. The hemocytes were re-suspended in ice cold DEPC treated PBS or Tris buffered saline and homogenized. Half of the samples were dedicated for estimating glucose, trehalose, and TPS activity, while the rest were used for RNA extraction as described above. Hemocyte protein was determined using BioRad DC protein assay (BioRad). Quantitative RT-PCR analysis (QRT-PCR)The extraction and quantification procedures of total RNA of hemocytes and cDNA synthesis were stated in Chung and Zmora [27]. Standards for QRT-PCR were produced as described [25]. Sample cDNAs (12.5 – 25 ng) were analyzed for the estimation of the expressions of TPS using primers of QF: 5' ATGTTGGTGGAACACAATTCAAGGAC3' and QR: 5' CTTTGTATAATCTAACCGATCCACTC3' and the data were calculated as copy number/μg of total RNA of hemocytes. The level of hemocyte trehalase (Treh, GenBank accession no. EU679407) was quantified using the following primers, QF: 5' GCAGAGAGTGGATGGGA3' and QR: 5' CCCTGACAGCAGCAAGCCCTCA3'. The expression levels of TPS and Treh were represented as copy number/μg total RNA as described [26]. Estimation of glucose and trehalose in hemocytesGlucose levels in hemocytes were determined using glucose oxidase/peroxidase assay (Sigma) as described [28]. Trehalose concentration in hemocytes was estimated by subtracting the amount of glucose from the values determined by anthrone assay, as this assay measures both sugars [29]. Trehalose (Sigma) was used for the standard of anthrone assay. The results were presented as μg glucose or mg trehalose/mg protein in hemocyte extracts. Two-step TPS activity assayTPS activity in hemocytes was estimated using a modified procedure that was previously described [30,31]. For the first step of the synthesis of trehalose 6-phospate, 100 μg of extracts from hemocytes was incubated in 200 μl final volume of the first reaction mixture containing 50 mM HEPES buffer (pH 7.1), 5 mM UDP-glucose (UDPG), 10 mM glucose-6-phosphate, and 12.5 mM MgCl2 at 35°C for 30 min. In controls, glucose-6-phosphate was omitted. The reactions were terminated with heat treatment at 100°C for 5 min and were centrifuged at 13,000 rpm for 5 min at room temperature. For the second step, the supernatants (150 μl) were further incubated at 35°C for 10 min in the following reaction mixture (150 mM HEPES buffer, pH 7.6, 2 mM phosphoenolpyruvate, 0.5 mM NADH, 5 U lactic dehydrogenase and 5 U pyruvate kinase). Samples were cooled on ice for 5 min and briefly centrifuged for 13,000 rpm for 1 min. 100 μl of the supernatant was placed into a 96 well plate, and the absorbance was measured at 340 nm (Spectra M5, Molecular Device). Known concentrations of UDP at 1000, 500, 250, 125, and 62.5 nmol were treated as above and served for a standard curve. TPS activity was calculated per μmol UDP/h/mg hemocyte protein. Trehalose 6-phosphate phosphatase (TPP) assayIn order to test the functionality of TPP domain of CasHemoTPS, the hemocytes were extracted in Tris-buffered saline and TPP enzyme activity was measured by following the procedure described in Klutts et al. [32]. The activity was calculated as μmol [Pi]/h/mg hemocyte protein. Estimation of TPS activity in hemocytes during molt cycleHemolymph samples were collected from animals at molt stages as described [33] and assayed as described above. Hemocytes homogenized in 200 μl of ice cold PBS by sonication (Branson); the extracts were centrifuged at 14,000 rpm for 10 min at 4°C; and, the supernatants were collected for the estimation of protein concentration as described above. Statistical analysisStatistical significance was determined at P < 0.05 using GraphPad InStat 3 program (GraphPad Software, Inc). AbbreviationsTPS: trehalose 6-phosphate synthase gene; Treh: trehalase Competing interestsThe author declares that they have no competing interests. Authors' contributionsJSC carried out the molecular cloning of TPS gene, TPS and TPP bioassays, and the bioassays. AcknowledgementsJSC thanks O. Zmora and the personnel in the blue crab hatchery program for the juvenile crabs and S. Rogers and the ARC personnel for maintaining the water quality of the re-circulation system. This article is contribution no. 08-193 of the Center of Marine Biotechnology (University of Maryland Biotechnology Institute, Baltimore, MD, USA), and the work is supported by a program grant (NA17FU2841) from NOAA Chesapeake Bay Office to the Blue Crab Advanced Research Consortium. References
Have something to say? Post a comment on this article! |





on Google Scholar








author email
corresponding author email
Figure 1.
Figure 2.
Figure 3.
Figure 4.